mRNA in vitro transcription (IVT)
Synthesise translatable mRNA from a linear DNA template using T7 polymerase. With co-transcriptional capping and modified UTPs, the product is ready for transfection without additional capping/modification steps.
Template requirements
- Linear DNA — PCR product OR linearised plasmid (cut downstream of poly-A).
- 5′ → 3′ structure: T7 promoter (TAATACGACTCACTATAGGG) – 5′ UTR – CDS – 3′ UTR – poly(A)~120 – run-off site.
- The first transcribed nucleotide is the G of "GGG" — required for T7.
- Use a high-fidelity polymerase (Q5) and gel-clean the template.
IVT reaction (20 µL, NEB HiScribe T7 high-yield kit + co-transcriptional cap)
| Component | Volume |
|---|---|
| Nuclease-free H₂O | to 20 µL |
| 10× reaction buffer | 2 µL |
| 100 mM ATP | 2 µL |
| 100 mM CTP | 2 µL |
| 100 mM GTP (or 4 mM if using CleanCap) | 2 µL (low GTP) |
| 100 mM N1-methylpseudo-UTP (m1ψ) | 2 µL |
| 40 mM CleanCap AG (TriLink) — optional but recommended | 2 µL (4 mM final) |
| Linear DNA template | 1 µg in ≤ 4 µL |
| T7 RNA polymerase mix | 2 µL |
For unmodified mRNA, replace m1ψ with regular UTP. For animal-grade mRNA always use modified bases — they reduce TLR3/7/8 activation.
Procedure
- Set up reaction at room temperature (Mg²⁺ precipitates with cold spermidine in the buffer).
- Incubate at 37 °C, 2–3 h. Longer (4–16 h) increases yield up to ~5 mg/mL but risks more dsRNA byproducts.
- Add 2 µL DNase I (RNase-free). Incubate 37 °C, 15 min, to degrade template.
- Purify:
- Quick: lithium chloride precipitation (add 1 vol 4 M LiCl, incubate 30 min on ice, spin, wash 70% EtOH).
- Better: silica column (Zymo RNA Clean & Concentrator) or magnetic beads (NEB Monarch RNA, Oligo dT for mRNA-specific).
- For low-immunogenicity (research-grade therapeutic): cellulose binding to remove dsRNA, or HPLC.
- Quantify on NanoDrop or Qubit RNA HS. Expected yield: 50–200 µg per 20 µL reaction.
- QC: run 200 ng on a denaturing agarose gel or BioAnalyzer. Expect a single sharp band of expected size.
- Aliquot in nuclease-free water at 1 µg/µL. Store at −80 °C. Avoid freeze-thaw.
Transfection of mRNA
- Use Lipofectamine MessengerMAX (per manufacturer) or RNAiMAX, NOT regular Lipo 3000.
- Typical doses: 0.5–1 µg per well of a 24-well, 1–2 µg per 6-well.
- Translation peaks at 4–24 h depending on UTRs and modifications.
Notes
- Work RNase-free: dedicated tips, decontaminate bench with RNase-Zap.
- Cap analogue (CleanCap AG, ARCA) needed for cap-dependent translation. Without it, eukaryotic mRNA is barely translated and very immunogenic.
- For poly(A) tail consistency, encode a poly(A) on the template (cleanest) rather than tailing post-IVT.
- Use modified UTPs (m1ψ or 5-methoxy-U) for therapeutic-style applications; reduces TLR-mediated immune activation ~100×.